Platelets from viscerally obese patients promote colon cancer growth

0

Study population

Patient recruitment was carried out in the Department of Interdisciplinary Medicine, Division of Internal Medicine, “Aldo Moro” University of Bari, Italy. Twenty healthy subjects and 20 patients with first diagnosis of metabolic syndrome and OV were recruited for this study (baseline characteristics are shown in Supplementary Table 1). The diagnosis of metabolic syndrome was assessed according to Adult Treatment Panel III (presence of three or more criteria). Waist circumference (WC) was considered a marker of VO. Accordingly, VO is defined as WC > 102 cm for men or > 88 cm for women. Cardiovascular risk was calculated using the Progetto Cuore scoring system. The study was conducted in accordance with the Declaration of Helsinki Principles and the protocol was approved by the ethics committee of Azienda Ospedaliero-Universitaria Policlinico di Bari, Italy. All patients gave their written informed consent.

Xenograft mouse model

A suspension of colorectal cells (100 µL; 1 × 10seven HT29 cells from the American Type Culture Collection, Manassas, VA) were injected subcutaneously into the subscapular region of an athymic mouse (CD1 nude mouse; The Jackson Laboratory)25. Eight-week-old female mice were used in each group of experiments. The tumors were not salvaged until the diameter had increased to nearly 0.3 to 0.5 cm. The animals were treated with a pool of platelets isolated from VO or control patients and AAV-EGFP or AAV-miR-19a (Vector Biolabs, Malvern PA, USA). For the xenografts treated with human platelets, the mice were randomly divided into 2 groups, each group containing 10 mice (i.e. 20 tumors) as follows: platelet group of visceral obesity (VO) and platelet group of healthy subjects (group witness). Then, 100 µL of platelet suspension (106platelets) was injected directly into tumor-bearing mice in each group every 7 days for a total of 3 injections per mouse. For the xenograft treated with AAV, mice were randomly divided into 2 groups (10 mice/group) as follows: AAV-miR-19a group and AAV-EGFP group (control group). A single injection of 5 × 10ten Genome copies/ml (GC/ml) of AAV suspension were administered directly to tumor-bearing mice in each group. Tumor growth was measured when the long diameter (a) and short diameter (b) were calculated via a digital caliper, and the tumor volumes (V) were determined according to the formula V= ½a ·b2, and a tumor growth curve was plotted as a percentage. All mice were then sacrificed and tumors were harvested for further analysis. All mice received standard rodent diet and water ad libitum and stored under pathogen-free conditions in a temperature-controlled room (23°C) on a 12 h light/dark cycle. The Ethics Committee of the University of Bari and the Fondazione “Mario Negri” Sud authorized this protocol, which was also approved by the Italian Ministry of Health in accordance with internationally accepted guidelines for animal care.

Wafer isolation

Platelets were isolated from whole blood and anticoagulated with 3.8% sodium citrate. Platelet-rich plasma (PRP) was prepared by centrifugation of citrated blood at 200 g for 20 min at 25°C. Platelets were pelleted at 1000 g for 15 min then washed with prostaglandin E1 (PGE1) (Sigma, Italy) and resuspended in ice-cold HEPES-Tyrode buffer (pH 7.4) containing 129 mM NaCl, 8.9 mM NaHCO3, 2.8 mM KCl, 0.8 mM KH2PO4, 56 mM dextrose, 10 mM HEPES. After sedimentation, the platelets were washed twice in this buffer. To isolate platelets, HEPES was used as a pH buffer in Tyrode’s solution. pH buffers such as Tris (tris[hydroxymethyl]aminomethane) should be avoided because, like other amines, they inhibit some platelet responses and potentiate others.

miRNA sequencing

MicroRNA-Seq libraries were prepared from 100 ng of small RNA isolated from platelet samples, according to the Illumina TruSeq small RNA sample preparation protocol (Illumina). MiRNA-Seq libraries were pooled in equimolar ratios (4 libraries per run), denatured and diluted to a final concentration of 10 pM, and sequenced on the Illumina MiSeq platform, yielding approximately 2-4 million reads of 50 bp/sample . The adapter removal was done using a custom Perl script. Expression levels were assessed by aligning reads between 17 and 25 bp in size on the complete collection of mature human miRNAs (obtained from miRBase, version 21) allowing up to 1 mismatch. The number of reads was normalized using adjusted mean normalization as applied in the edgeR package. Differential expression analysis was performed using the latest version of limma (v3.32) and edgeR (v3.18) packages in R. miRNA target prediction was performed using Target Scan. Enrichment analysis of the gene set was performed using the EnrichR package. Sequencing data is freely available through the SRA BioProject PRJNA820035.

Extraction of RNA and miRNA

Total RNA was extracted with Qiazol reagent (Qiagen) following the manufacturer’s instructions. cDNA was synthesized by back-transcribing 4 μg of total RNA in a total volume of 100 μL using a high capacity DNA archival kit (Thermo Fisher Scientific) according to the manufacturer’s instructions. Isolation of miRNAs was performed using the mirVana™ miRNA Isolation Kit (Thermo Fischer, MA, USA) according to the manufacturer’s guidelines. Isolation of plasma miRNAs was performed using the miRNaesy Advanced Serum/Plasma Kit (Qiagen, GmbH) according to the manufacturer’s guidelines. RNA quality was assessed by absorbance at 260 nm with a Nanodrop spectrophotometer (NanoDrop Technologies Inc., Wilmington, DE, USA) and by capillary electrophoresis with an Agilent2100 bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). For miRNA expression analysis, reverse transcription was performed using the TaqMan microRNA Reverse Transcription Kit (Thermo Fisher Scientific, MA, USA), following the manufacturer’s instructions.

Real-time quantitative PCR

For genes: Real-time quantitative PCR (RTqPCR) primers were designed using Primer Express software. Cyclophilin was used as an internal control. Primer sequences validated for RTqPCR are: TNFα FW CCTCTGGCCCAGGCAGT RV AGGCTTGTCACTCGGGGTT ; cyclophilin FW CATCTGCACTGCCAAGACTGAG RV CCTTCACTTTGCCAAACACCAC. For PTEN and SMAD4 RTqPCR we used an IDT validated primer (PTEN code: Hs.PT.53.26587300; SMAD4 code: Hs.PT.58.472774). For miRNAs: qPCR assays were performed using pre-validated TaqMan assays and TaqMan Universal Master Mix (Thermo Fisher Scientific, MA, USA), following manufacturer’s instructions. Quantitative normalization was performed using miR-374 and RNU6B as internal controls. For all experiments, PCR assays were performed in 96-well optical reaction plates using the QuantStudio5 machine (Thermo Fisher Scientific). The relative quantification was carried out via the ΔΔCT method.

Histology and immunohistochemistry

Tissue samples were fixed in 10% formalin for 12–24 h, dehydrated, and paraffin embedded. Sections 4 µm thick were stained with hematoxylin-eosin (H&E) according to the standard protocol. For antigen retrieval, slides were boiled in sodium citrate pH 6 (Sigma Aldrich, Milan, Italy) for 15 min. Sections were permeabilized in phosphate buffered saline (PBS) with 0.25% TritonX-100 for 5 min, then incubated at room temperature in protein blocking solution for 10 min (Dako, Glostrup, Denmark) and overnight at 4°C with the primary antibody (anti-pcna 1:100, Santa Cruz Biotechnology, Santa Cruz, CA; or anti-PTEN 1:2000, Abcam, Cambridge, UK or anti-SMAD4 1 :400, Abcam, Cambridge, UK). The sections were rinsed in PBS (15 min) and incubated at room temperature with the DAKO real EnVision Peroxidase/DAB detection system+ (25 min, Dako, Glostrup, Denmark) according to the manufacturer’s instructions. The image analysis was carried out using the Image J software. For each sample, 10 representative images were acquired with a 20x objective. The percentage of stained surface/total surface was evaluated. The values ​​of all consecutive images for each sample were averaged. For negative controls, 1% non-immune serum in PBS replaced the primary antibodies.

Gene Expression Omnibus Analysis

We assessed potential GEO datasets according to the following inclusion parameters: (1) histological diagnosis; (2) colorectal cancer or adenoma for the experimental group; (3) normal intestinal mucosa used as control; (4) Non-coding RNA profiling by template and raw data required CEL or TXT format; (5) performed on the GPL18402 (Agilent-046064Unrestricted_Human_miRNA_V19.0_Microarray) and Affymetrix Multispecies miRNA-3 Array. Datasets with samples from other organisms, expression profiling by RT-PCR, or sample size

Statistics and reproducibility

All results are expressed as mean ± SEM in scatter plots. Data distribution and statistical analysis of gene expression were analyzed using GraphPad Prism software (v5.0; GraphPad Software Inc., San Diego, CA). The comparisons of two groups were made using a Student’s test. you test. Comparison of the different groups was performed using one-way ANOVA followed by Tukey’s test for multiple comparison. A pa value

Summary of reports

Further information on the research design can be found in the summary of nature research reports linked to this article.

Share.

About Author

Comments are closed.